Journal: bioRxiv

Article Title: Type 1 diabetes risk genes mediate pancreatic beta cell survival in response to proinflammatory cytokines

doi: 10.1101/2021.10.29.466025

Figure Lengend Snippet: A) T1D GWAS regional association plot showing two independent signals at the DEXI/SOCS1 locus. B) Fine mapping posterior probabilities of the secondary signal. Variants with SNP-SELEX significant effect on differential TF binding and within a cytokine-responsive cCRE are highlighted in red. C) Genome-browser of the DEXI/SOCS1 locus showing bullk ATAC-seq tracks from human islets after the indicated treatments and gene annotations. D) SNP-SELEX results for the candidate variant rs35342456. 2cyt: cytokine treatment with IL1b and IFNg, 3cyt: cytokine treatment with IL1b, IFNg and TNFa, lo: low-dose, hi: high-dose, untr: untreated. E) EMSA with nuclear extract (NE) from MIN6 cells showing preferential binding to probes with the reference allele, consistent with SNP-SELEX results. F) Zoom in of the locus showing location of the candidate variant rs35342456 (yellow vertical line) in a cytokine-up regulated beta cell peak that is co-accessible and show HiChIP interaction with SOCS1 promoter in cytokine-treated beta cells and EndoC-βH1 respectively. G) Count number of each sgRNA in the CRISPR-KO screen targeting SOCS1 in untreated ang high-cytokine treated Endoβ-CH1, normalised to the sequencing depth of each sample, showing higher counts in untreated samples for five out of six sgRNAs. Counts for the same sgRNA in the two conditions are connected with a line. H) Normalized and batch-corrected expression of SOCS1 in human islet samples after different cytokine treatment conditions. DESeq p-value and log 2 fold change are from DESeq, showing significant (FDR<0.1) higher expression between 3-cytokine, high-doses treated islets (red) vs untreated (purple). H) Effect of Socs1 knock-down by siRNA on cell death-induced DNA fragmentation using an anti-BrdU ELISA in MIN6 cells. ANOVA p-values testing effect of both siRNA and treatment are shown on the top. Two-tailed t-test p-values are shown for pairs of Socs1/scramble siRNA in each treatment condition. Error bars represent standard deviation. 2cyt: cytokine treatment with IL1b and IFNg, 3cyt: cytokine treatment with IL1b, IFNg and TNFa, lo: low-dose, hi: high-dose, untr: untreated.

Article Snippet: Sense and anti-sense single-stranded EMSA oligonucleotides for reference and alternate alleles were purchased from Integrated DNA Technologies, with the following sequences: rs10483809 ( RAD51B ): 5’Biotin–ATCTTTCACTTTCCCT[ A/G ]TCGATACTTCATATGT rs35342456 ( SOCS1 ): 5’Biotin–GCTGGGCGTGGTGGCTCACGCCTGT [A/C] ATCTTGTTG Binding reaction mixtures were prepared for each allele and contained 10x Binding Buffer, 50% glycerol, 0.1M MgCl 2 , 1μg/μL in 10mM Tris Poly(dI*dC), 1% NP-40 (20148, ThermoFisher Scientific), 100fmol and 25fmol of labeled probe for rs10483809 and rs35342456 respectively, and 8-17 μg NE.

Techniques: Binding Assay, Variant Assay, HiChIP, CRISPR, Sequencing, Expressing, Enzyme-linked Immunosorbent Assay, Two Tailed Test, Standard Deviation